An simple interval class for DNA sequences from FASTA files that provides fast access to sequences and methods for interval logic on those sequences.
An online version of the documentation should be available at http://fastinterval.readthedocs.org/
Usually you will create a Genome and then use that object to create intervals. The intervals have a sequence property that will look up the actual sequence:
>>> from fastinterval import Genome, Interval
>>> test_genome = Genome('test/example.fa')
>>> int1 = test_genome.interval(100, 150, chrom='1')
>>> print int1
1:100-150:
>>> print int1.sequence
GATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGA
fastinterval uses pyfasta to retrieve the sequence, so the access is mmapped (i.e fast). It supports strandedness, which will be respected when accessing the sequence:
>>> int2 = test_genome.interval(100, 150, chrom='1', strand=-1) >>> print int2.sequence TCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATC
The Interval class supports many interval operations:
>>> int1 = test_genome.interval(100, 150, chrom='1') >>> int2 = test_genome.interval(125, 175, chrom='1') >>> int1.distance(int2) 0 >>> int1.span(int2) Interval(100, 175) >>> int1.overlaps(int2) True >>> int1.is_contiguous(int2) True >>> int1 in int2 False >>> int1.intersection(int2) Interval(125, 150) >>> int1.union(int2) Interval(100, 175) >>> Interval.merge([int1, int2, test_genome.interval(200,250, chrom='1')]) [Interval(100, 175), Interval(200, 250)]
The Interval class is also based on bx python intervals. So you can pass in a value attritbue to point to an external object, and create interval trees and so on.
>>> from bx.intervals.intersection import IntervalTree >>> int3 = test_genome.interval(150, 200, chrom='1', value='foo') >>> tree = IntervalTree() >>> _ = map(tree.insert_interval, (int1, int2, int3)) >>> tree.find(190, 195) [Interval(150, 200, value=foo)]