Adam 2.0 is a design utility for hybridization oligos. Given a pool of sequences, provided as a file in FASTA format, the utility outputs putative identification primers that meet the user's design specifications. The program uses k-mer based approach that works in the following way:
- Given a set of sequences, find the minimum k-mer length that splits all sequences up into unique, unambiguous k-mers
- Break all sequences into unique k-mers using the identified value of k
- Remove from consideration all k-mers that occur multiple times within the collection of sequences of interest (only consider unique kmers)
- Generate a matrix of Hamming distances between all unique k-mers within a single sequence and all other k-mers from all other sequences
- Remove all rows that contain a Hamming distance of 1 for any k-mer pair (unique k-mers must be at least 2 mutations from any other k-mer in the pool)
- Map Hamming distances to similarity scores S by calculating S = k−Hamming distance and minimize the sum of the squared similarity scores
- Find k-mer within original sequence
- Perform sliding window primer design of varying size until desired Tm and other properties are achieved (check with primer3) to generate a pool of potential hybridization oligos
- Prune the oligo pool to a single representative oligo based on pruning properties
- Report the hybridization oligos in a machine/human readable format
Adam 2.0 requires Python 3.
Installation is as easy as:
git clone https://github.com/FordyceLab/adam2.git
cd adam2
pip3 install .
This will make the adam2 command line tool publicly available. You can check this with which adam2, which should not return a blank line.
Adam 2.0 (command line tool adam2) takes a requires set of IO/ parameters and has three sets of command line options used to alter its behavior:
--inputor-i- specifies the input FASTA file containing sequences for oligo design (required argument)--outputor-o- specifies the output file prefix (required argument)
--sizeor-s- desired oligo size range, must provide min and max (required argument)--tmor-t- desired oligo Tm range in degrees C, must provide min and max (required argument)--hairpinor-p- hairpin tolerance in degrees C, default = 10--homodimeror-d- homodimer tolerance in degrees C, default = 10--numberor-n- number of oligos to generate per input sequence, default = 10
--length- length penalty for oligo scoring, default = 0.5--gc_ends- GC ends reward for oligo scoring, default = 1--gc_comp- GC composition penalty for oligo scoring, default = 2--tm_mean- Tm mean penalty for oligo scoring, default = 1--hairpin_tm- hairpin Tm suppression reward for oligo scoring, default = 0.1--homodimer_tm- homodimer Tm suppression reward for oligo scoring, default = 0.1
--dna_conc- DNA concentration to use for Tm calculation, default = 250--mv_conc- monovalent cation concentration to use for Tm calculation, default = 50--dv_conc- divalent cation concentration to use for Tm calculation, default = 0--dntp_conc- dNTP concentration to use for Tm calculation, default = 0
Let's say we have the following FASTA file (named species.fasta on disk) containing a variable region for two species below:
>Species_A
ACGTTGACAGGATTACACAGTAGATCCAGGATTATAGGACCAGGTAGCA
>SpeciesB
ACGTTTGACGTTGTACACAGTAGAGGCTAGGATTAGGTACCAGGTAGCA
We want to design a set of oligos to separate these sequences with the following parameters:
- max of 3 potential oligos designed per species
- length of 18-25 nt
- Tm of 55-60C
We can accomplish this using the following command:
adam2 -i species.fasta -o species -n 3 -s 18 25 -t 55 60
This command will generate the following YAML file (in this case named species.yaml):
design_params:
k: 9
size_range: (18, 25)
Tm_range: (55.0, 60.0)
hairpin_tolerance: 10
homodimer_tolerance: 10
prune_params:
GC_ends: 1
GC_comp: 2
Tm_mean: 1
hairpin_Tm: 0.1
homodimer_Tm: 0.1
Species_A:
ACGTTGACAGGATTACACAGTAGAT:
length: 25
Tm: 55.39
start: 0
end: 24
hairpin_Tm: 0.0
homodimer_Tm: -46.54
SpeciesB:
CGTTTGACGTTGTACACAGTAGAG:
length: 24
Tm: 55.69
start: 1
end: 24
hairpin_Tm: 32.83
homodimer_Tm: -11.0
CACAGTAGAGGCTAGGATTAGGTAC:
length: 25
Tm: 55.11
start: 15
end: 39
hairpin_Tm: 0.0
homodimer_Tm: -31.25
